Search This Blog

Saturday, October 21, 2017

Genome Informatic 2017

Assignment 5 (EKAWAT PASOMSUB)

Topic :
SNPs

Please use the file already send you in LINE, then answer the following question;
1.What is the name of haploview format to use in this analysis?
2.Please show us the marker and individual quality control of the genotype data use in the analysis?
3.Please show us the LD map then explain what do you get from the LD map?
4.How many haplotype blocks? Explain how to interpret them?

5.Could you find out the tagging SNP in each haplotype block, then explain what the tagging SNPs?

Deadline will be MidNight of 3/12/2017

#################################################################################

Assignment 4 (EKAWAT PASOMSUB)

Topic :
Phylogenetic tree


Who are the ancestors of the dinosaurs?
Science 1994 Nov 18;266(5188):1229-1232

DNA was extracted from 80-million-year-old bone fragments found in strata of the Upper Cretaceous Blackhawk Formation in the roof of an underground coal mine in eastern Utah.

This DNA was used as the template in a polymerase chain reaction that amplified and sequenced a portion of the gene encoding mitochondrial cytochrome b.

These sequences differ from all other cytochrome b sequences investigated, including those in the GenBank and European Molecular Biology Laboratory databases.

DNA isolated from these bone fragments and the resulting gene sequences demonstrate that small fragments of DNA may survive in bone for millions of years.

The authors conclude that the DNA sequence,

cccttctattattcattctcattctattcgttattcttgtactccacacatccaaacaacaaag
cataatattccacccattgagtccattcctatcctgattcttagtccccgaaccttttacactcacatg

,appears to be from a dinosaur that lived 80 million years ago.

Show us step by step of how to do phylogenetic analysis with cytochrome b sequences. Then, what is your conclusion about the structure of the tree and the position of the dinosaur sequence that might come close to these following species?

Use these following species
o Human
o Dog
o Rabbit
o rhinoceros
o dugong
o mouse
o whale
o bovine
o sicklebill
o chicken
o magpie
o frog


Hint: You need to create a phylogentic tree. But first you need to get the cytochrome b nucleotide sequences for the different species from NCBI.


Deadline will be MidNight of 3/12/2017

#############################################################################



Assignment 3 (EKAWAT PASOMSUB)

Topic :
Similarity search and Alignment / BioEdit


Assignment 3.1 - Similarity search and alignment

Please choose one of the following sequence from the link below

http://www.mediafire.com/view/3ke6ghji71ohdn2/Sequence_assignment3.txt

Then make a simailarity search against the sequences on NCBI database. Compare the result between BLASTN and BLASTP, then make the discussion about the result. What do you get from the BLAST result?


Assignment 3.2 - BioEdit

Please choose one of the following sequence to make (you can use the same sequence from assignment 3.1);
1.sequence complementary
2.six frame translation
3.restriction enzyme analysis
4.make multiple alignment with at least 5 sequences (try to find the related sequence from database with difference subtypes/species)
5.make consensus sequence with cutoff 60%

Special score !!!! . 
Make the identity/similarity matrix from using MATGAT
MATGAT have to use Java, you can download the java from this link 

http://bit.ly/2xVcxtL

Then discussion of the result compare with the original sequence you selected.


Deadline will be MidNight of 5/11/2017


#################################################################